Accessing databases

NCBI

EUtils is a web service offered by the NCBI to access the sequence, literature and other databases by a special format of URLs. PyCogent offers an interface to construct the URLs and retrieve the results in text format.

From Pubmed

Retrieving PubMed records from NCBI by PubMed ID

The process for getting PubMed records by PubMed ID (PMID) is very similar to that for getting sequences. Basically, you just need to pass in the unique id associated with the article. For example, if you want to get the reference to the original PyCogent paper to see how far we’ve come since then, you can do this:

>>> from cogent.db.ncbi import EFetch
>>> ef = EFetch(id='17708774', db='pubmed', rettype='brief')
>>> ef.read()
'\n1. Genome Biol. 2007;8(8):R171.\n\nPyCogent: a toolkit...

If you want more information, there are other rettypes, e.g.

>>> ef = EFetch(id='17708774', db='pubmed', rettype='citation')
>>> ef.read()
'\n1. Genome Biol. 2007;8(8):R171.\n\nPyCogent: a toolkit for...

Similarly, if you want something more machine-readable (but quite a lot less human-readable), you can specify XML in the retmode:

>>> ef = EFetch(id='17708774', db='pubmed', rettype='citation', retmode='xml')
>>> cite = ef.read()
>>> for line in cite.splitlines()[:5]:
...     print line
...
<?xml version="1.0"?>
<!DOCTYPE PubmedArticleSet PUBLIC "-//NLM//DTD PubMedArticle, 1st January 2016//EN" "http://www.ncbi.nlm.nih.gov/corehtml/query/DTD/pubmed_160101.dtd">
<PubmedArticleSet>
<PubmedArticle>
    <MedlineCitation Owner="NLM" Status="MEDLINE">

Only a partial example is shown as there are quite a few lines. As with sequences, you can retrieve multiple accessions at once.

Searching for records using EUtils

Getting records by their primary identifiers is very nice if you actually have the primary identifiers, but what if you don’t? For example, what if you want to do a search based on a keyword, or have a genbank accession number rather than a gi, or want to get a range of records?

Fortunately, the more general EUtils class allows this kind of complex workflow with relatively little intervention. For example, if you want to search for articles that mention PyCogent:

>>> from cogent.db.ncbi import EUtils
>>> eu = EUtils(db='pubmed', rettype='brief')
>>> res = eu['PyCogent']
>>> print res.read()

1. J Appl Crystallogr. 2011 Apr 1;44(Pt 2):424-428. Epub 2011 Feb 11.

Abstractions, algorithms and data structures for structural bioinformatics in
PyCogent.

Cieślik M, Derewenda ZS, Mura C...

…or perhaps you want only the ones with PyCogent in the title, in which case you can use any qualifier that NCBI supports:

>>> res = eu['PyCogent[ti]']
>>> print res.read()

1. J Appl Crystallogr. 2011 Apr 1;44(Pt 2):424-428. Epub 2011 Feb 11.

Abstractions, algorithms and data structures for structural bioinformatics in
PyCogent.

Cieślik M, Derewenda ZS, Mura C...

The NCBI-supported list of field qualifiers, and lots of documentation generally on how to do pubmed queries, is here.

One especially useful feature is the ability to get a list of primary identifiers matching a query. You do this by setting rettype='uilist' (not idlist any more, so again you may need to update old code examples). For example:

>>> eu = EUtils(db='pubmed', rettype='uilist')
>>> res = eu['PyCogent']
>>> print res.read()
22479120
18230758
17708774

This is especially useful when you want to do a bunch of queries (whether for journal articles, as shown here, or for sequences), combine the results, then download the actual unique records only once. You could of course do this with an incredibly complex single query, but good luck debugging that query…

For sequences

Fetching FASTA or Genpept sequences from NCBI using EFetch with GI’s

If you already have a list of GI’s (the numeric identifiers that are used by GenBank internally as identifers), your job is very easy: you just need to use EFetch to retrieve the corresponding records. In general, this works for any case where the identifiers you have are the primary keys, e.g. for PubMed you use the PubMed ID (see example below).

Here is an example of getting the nucleotide record that corresponds to one particular id, in this case id # 459567 (chosen arbitrarily). The record arrives as a file-like object that can be read; in this case, we are looking at each line and printing the first 40 characters.

>>> from cogent.db.ncbi import EFetch
>>> ef = EFetch(id='459567', rettype='fasta')
>>> lines = ef.read().splitlines()
>>> for line in lines:
...     print line[:40]
...
>gi|459567|dbj|D28543.1|HPCNS5PC Hepatit
GAGCACGACATCTACCAATGTTGCCAACTGAACCCAGAGG
GGCTTTACCTTGGTGGTCCCATGTTTAACTCGCGAGGTCA
CGGGGTTCTTCCAACCAGCATGGGCAATACCCTCACATGT
GCAGGCCTCACCAATTCTGACATGTTGGTTTGCGGAGATG
TC

Similarly, if your id refers to a protein record, you can get that by setting the rettype to ‘gp’.

>>> genpept = EFetch(id='1234567,459567', rettype='gp').read()

The current rettypes (as of this writing on 4/14/2010) for the ‘core’ NCBI databases are native, fasta, gb, gp, gbwithparts, gbc, gpc, est, gss, seqid, acc, ft. Formerly, but not currently, ‘genbank’ was a synonym for ‘gb’ and ‘genpept’ was a synonym for ‘gp’: however, these synonyms no longer work and need to be fixed if you encounter them in old code. For more information check NCBI’s format documentation.

Note that there are two separate concepts: rettype and retmode. rettype controls what kind of data you’ll get, and retmode controls how the data will be formatted.

For example:

>>> from cogent.db.ncbi import EFetch
>>> ef = EFetch(id='459567', rettype='fasta', retmode='text')
>>> lines = ef.read().splitlines()
>>> for line in lines:
...     print line[:40]
...
>gi|459567|dbj|D28543.1|HPCNS5PC Hepatit
GAGCACGACATCTACCAATGTTGCCAACTGAACCCAGAGG
GGCTTTACCTTGGTGGTCCCATGTTTAACTCGCGAGGTCA
CGGGGTTCTTCCAACCAGCATGGGCAATACCCTCACATGT
GCAGGCCTCACCAATTCTGACATGTTGGTTTGCGGAGATG
TC

>>> ef = EFetch(id='459567', rettype='fasta', retmode='html')
>>> lines = ef.read().splitlines()
>>> for line in lines:
...     print line[:40]
...
Seq-entry ::= set {
  level 1 ,
  class nuc-prot ,
  descr {
    pub {
      pub {
        sub {
          authors {
            names
              std {
                {...
>>> ef = EFetch(id='459567', rettype='fasta', retmode='xml')
>>> lines = ef.read().splitlines()
>>> for line in lines:
...     print line[:40]
...
<?xml version="1.0"?>
 <!DOCTYPE TSeqSet PUBLIC "-//NCBI//NCBI
 <TSeqSet>
<TSeq>
  <TSeq_seqtype value="nucleotide"/>
  <TSeq_gi>459567</TSeq_gi>
  <TSeq_accver>D28543.1</TSeq_accver>
  <TSeq_taxid>11103</TSeq_taxid>
  <TSeq_orgname>Hepatitis C virus</TSeq_
  <TSeq_defline>Hepatitis C virus gene f
  <TSeq_length>282</TSeq_length>
  <TSeq_sequence>GAGCACGACATCTACCAATGTTG...

You’ll notice that the second case is some funny-looking html. Thanks, NCBI! This is not our fault, please don’t file a bug report. To figure out whether something is actually surprising behavior at NCBI, you can always capture the command-line and run it in a web browser. You can do this by calling str() on the ef, or by printing it. For example:

>>> print ef
http://www.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmax=100&retmod...

If you paste the resulting string into your web browser and you get the same incorrect result that you get using PyCogent, you know that you should direct your support requests NCBI’s way. If you want to use your own email address instead of leaving it as the default (the module developer), you can do that just by passing it in as a parameter. For example, in the unlikely event that I want NCBI to contact me instead of Mike if something goes wrong with my script, I can achieve that as follows:

>>> ef = EFetch(id='459567', rettype='fasta', retmode='xml', email='rob@spot.colorado.edu')
>>> print ef
http://www.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?retmax=100&retmod...

You can also select multiple ids (pass in as comma-delimited list):

>>> ef = EFetch(id='459567,459568', rettype='summary', retmode='xml')
>>> print ef.read()
<?xml version="1.0"?>
 <!DOCTYPE Bioseq-set PUBLIC "-//NCBI//NCBI Seqset/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_Seqset.dtd">
 <Bioseq-set>
 <Bioseq-set_seq-set>
<Seq-entry>
  <Seq-entry_set>
    <Bioseq-set>
      <Bioseq-set_level>1</Bioseq-set_level>
      <Bioseq-set_class value="nuc-prot"/>
      <Bioseq-set_descr>...

Retrieving GenPept files from NCBI via Eutils

We query for just one accession to illustrate the process. A more general query can be executed by replacing 'BAB52044 with '"lysyl tRNA-synthetase"[ti] AND bacteria[orgn]' in the snippet below.

>>> from cogent.db.ncbi import EUtils
>>> e = EUtils(numseqs=100, db='protein', rettype='gp')
>>> result = e['BAB52044']
>>> print result.read()
LOCUS       BAB52044                 548 aa            linear   BCT 16-MAY-2009
DEFINITION  lysyl tRNA synthetase [Mesorhizobium loti MAFF303099].
ACCESSION   BAB52044
VERSION     BAB52044.1  GI:14025444
DBLINK      BioProject: PRJNA18
DBSOURCE    accession BA000012.4
KEYWORDS    .
SOURCE      Mesorhizobium loti MAFF303099...

Retrieving and parsing GenBank entries

>>> from cogent.parse.genbank import RichGenbankParser
>>> from cogent.db.ncbi import EUtils
>>> e = EUtils(numseqs=100, db='protein', rettype='gp')
>>> result = e['"lysyl tRNA-synthetase"[ti] AND bacteria[orgn]']
>>> parser = RichGenbankParser(result.readlines())
>>> gb = [(accession, seq) for accession, seq in parser]

Printing the resulting list (gb) will generate output like:

[('AAA83071', Sequence(MSEQHAQ... 505)), ('ACS40931', ...

Parsing in more detail: a single GenBank entry

>>> from cogent.db.ncbi import EUtils
>>> from cogent.parse.genbank import RichGenbankParser
>>> e = EUtils(db="nucleotide", rettype="gb")
>>> record = e['154102'].readlines()
>>> parser = RichGenbankParser(record)
>>> accession, seq = [record for record in parser][0]
>>> accession
'STYHEMAPRF'
>>> type(seq)
<class 'cogent.core.sequence.DnaSequence'>
>>> def gene_and_cds(f):
...     return f['type'] == 'CDS' and 'gene' in f
...
>>> cds_features = [f for f in seq.Info.features if gene_and_cds(f)]
>>> for cds_feature in cds_features:
...     print cds_feature['gene'], cds_feature['location']
...
['hemA'] 732..1988
['prfA'] 2029..3111

Retrieving a bacterial genome file

To obtain a full bacterial genome, run the following to get the complete Salmonella typhimurium genome sequence (Genbank) file. (For this documentation, we include a partial file for illustration purposes.)

from cogent.db.ncbi import EUtils
e = EUtils(db="nucleotide", rettype="gb")
outfile = open('data/ST.genome.gb','w')
outfile.write(e['AE006468'].read())
outfile.close()

For larger files, you might want to dump them directly into a file on your hard drive rather than reading them into memory first, e.g.

e.filename='ST.genome.gb'
f = e['AE006468']

dumps the result into the file directly, and returns you a handle to the open file where you can read the result, get the path, or do any of the other standard file operations. Now do the analysis:

>>> from cogent.parse.genbank import RichGenbankParser
>>> infile = open('data/ST_genome_part.gb', 'r')
>>> parser = RichGenbankParser(infile)
>>> accession, seq = [record for record in parser][0]
>>> gene_and_cds = lambda f: f['type'] == 'CDS' and 'gene' in f
>>> gene_name = lambda f: f['gene']
>>> all_cds = [f for f in seq.Info.features if gene_and_cds(f)]
>>> for cds in sorted(all_cds, key=gene_name):
...     print cds['gene'][0].ljust(6),
...     print cds['protein_id'], cds['location']
...
mog    ['AAL18972.1'] 8729..9319
talB   ['AAL18971.1'] 7665..8618
thrA   ['AAL18966.1'] 337..2799
thrB   ['AAL18967.1'] 2801..3730
thrC   ['AAL18968.1'] 3734..5020
thrL   ['AAL18965.1'] 190..255
yaaA   ['AAL18969.1'] complement(5114..5887)
yaaH   ['AAL18973.1'] complement(9376..9942)
yaaJ   ['AAL18970.1'] complement(5966..7396)

The EUtils modules are generic, so additional databases like OMIM can be accessed using similar mechanisms.

Retrieving PubMed abstracts from NCBI via EUtils

>>> from cogent.db.ncbi import EUtils
>>> e = EUtils(db='pubmed',rettype='brief')
>>> result = e['Simon Easteal AND Von Bing Yap'].read()
>>> print result

1. Mol Biol Evol. 2010 Mar;27(3):726-34. doi: 10.1093/molbev/msp232. Epub 2009 Oct
8.

Estimates of the effect of natural selection on protein-coding content.

Yap VB(1), Lindsay H, Easteal S, Huttley G...

Retrieving PubMed abstracts via PMID

>>> from cogent.db.ncbi import EUtils
>>> e = EUtils(db='pubmed',rettype='abstract')
>>> result = e['14983078'].read()

Ensembl

Note that much more extensive documentation is available in Querying Ensembl.

Connecting

Ensembl provides access to their MySQL databases directly or users can download and run those databases on a local machine. To use the Ensembl’s UK servers for running queries, nothing special needs to be done as this is the default setting for PyCogent’s ensembl module. To use a different Ensembl installation, you create an account instance:

>>> from cogent.db.ensembl import HostAccount
>>> account = HostAccount('fastcomputer.topuni.edu', 'username',
...                       'somepass')

To specify a specific port to connect to MySQL on:

>>> from cogent.db.ensembl import HostAccount
>>> account = HostAccount('anensembl.server.edu', 'someuser',
...                       'somepass', port=3306)

Species to be queried

To see what existing species are available

>>> from cogent.db.ensembl import Species
>>> print Species
================================================================================
       Common Name                   Species Name              Ensembl Db Prefix
--------------------------------------------------------------------------------
         A.aegypti                  Aedes aegypti                  aedes_aegypti
        A.clavatus           Aspergillus clavatus           aspergillus_clavatus...

If Ensembl has added a new species which is not yet included in Species, you can add it yourself.

>>> Species.amendSpecies('A latinname', 'a common name')

You can get the common name for a species

>>> Species.getCommonName('Procavia capensis')
'Rock hyrax'

and the Ensembl database name prefix which will be used for all databases for this species.

>>> Species.getEnsemblDbPrefix('Procavia capensis')
'procavia_capensis'

Species common names are used to construct attributes on PyCogent Compara instances). You can get the name that will be using the getComparaName method. For species with a real common name

>>> Species.getComparaName('Procavia capensis')
'RockHyrax'

or with a shortened species name

>>> Species.getComparaName('Caenorhabditis remanei')
'Cremanei'

Get genomic features

Find a gene by gene symbol

We query for the BRCA2 gene for humans.

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> print human
Genome(Species='Homo sapiens'; Release='81')
>>> genes = human.getGenesMatching(Symbol='BRCA2')
>>> for gene in genes:
...     if gene.Symbol == 'BRCA2':
...         print gene
...         break
Gene(Species='Homo sapiens'; BioType='protein_coding'; Description='breast cancer 2,...'; StableId='ENSG00000139618'; Status='KNOWN'; Symbol='BRCA2')

Find a gene by Ensembl Stable ID

We use the stable ID for BRCA2.

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> gene = human.getGeneByStableId(StableId='ENSG00000139618')
>>> print gene
Gene(Species='Homo sapiens'; BioType='protein_coding'; Description='breast cancer 2,...'; StableId='ENSG00000139618'; Status='KNOWN'; Symbol='BRCA2')

Find genes matching a description

We look for breast cancer related genes that are estrogen induced.

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> genes = human.getGenesMatching(Description='breast cancer anti-estrogen')
>>> for gene in genes:
...     print gene
Gene(Species='Homo sapiens'; BioType='protein_coding'; Description='breast cancer anti-estrogen...'; StableId='ENSG00000137936'; Status='KNOWN'; Symbol='BCAR3')...

We can also require that an exact (case insensitive) match to the word(s) occurs within the description by setting like=False.

>>> genes = human.getGenesMatching(Description='breast cancer anti-estrogen',
...                                  like=False)
>>> for gene in genes:
...     print gene
Gene(Species='Homo sapiens'; BioType='protein_coding'; Description='breast cancer anti-estrogen...'; StableId='ENSG00000137936'; Status='KNOWN'; Symbol='BCAR3')...

Get canonical transcript for a gene

We get the canonical transcripts for BRCA2.

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> brca2 = human.getGeneByStableId(StableId='ENSG00000139618')
>>> transcript = brca2.CanonicalTranscript
>>> print transcript
Transcript(Species='Homo sapiens'; CoordName='13'; Start=32315473; End=32400266; length=84793; Strand='+')

Get the CDS for a transcript

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> brca2 = human.getGeneByStableId(StableId='ENSG00000139618')
>>> transcript = brca2.CanonicalTranscript
>>> cds = transcript.Cds
>>> print type(cds)
<class 'cogent.core.sequence.DnaSequence'>
>>> print cds
ATGCCTATTGGATCCAAAGAGAGGCCA...

Look at all transcripts for a gene

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> brca2 = human.getGeneByStableId(StableId='ENSG00000139618')
>>> for transcript in brca2.Transcripts:
...     print transcript
Transcript(Species='Homo sapiens'; CoordName='13'; Start=32315473; End=32400266; length=84793; Strand='+')
Transcript(Species='Homo sapiens'; CoordName='13'; Start=32315504; End=32333291; length=17787; Strand='+')...

Get the first exon for a transcript

We show just for the canonical transcript.

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> brca2 = human.getGeneByStableId(StableId='ENSG00000139618')
>>> print brca2.CanonicalTranscript.Exons[0]
Exon(StableId=ENSE00001184784, Rank=1)

Get the introns for a transcript

We show just for the canonical transcript.

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> brca2 = human.getGeneByStableId(StableId='ENSG00000139618')
>>> for intron in brca2.CanonicalTranscript.Introns:
...     print intron
Intron(TranscriptId=ENST00000380152, Rank=1)
Intron(TranscriptId=ENST00000380152, Rank=2)
Intron(TranscriptId=ENST00000380152, Rank=3)...

Inspect the genomic coordinate for a feature

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> brca2 = human.getGeneByStableId(StableId='ENSG00000139618')
>>> print brca2.Location.CoordName
13
>>> print brca2.Location.Start
32315473
>>> print brca2.Location.Strand
1

Get repeat elements in a genomic interval

We query the genome for repeats within a specific coordinate range on chromosome 13.

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> repeats = human.getFeatures(CoordName='13', Start=32305473, End=32315473, feature_types='repeat')
>>> for repeat in repeats:
...     print repeat.RepeatClass
...     print repeat
...     break
SINE/Alu
Repeat(CoordName='13'; Start=32305225; End=32305525; length=300; Strand='-', Score=2770.0)

Get CpG island elements in a genomic interval

We query the genome for CpG islands within a specific coordinate range on chromosome 11.

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> islands = human.getFeatures(CoordName='11', Start=2129111, End=2149604, feature_types='cpg')
>>> for island in islands:
...     print island
...     break
CpGisland(CoordName='11'; Start=2137721; End=2141254; length=3533; Strand='-', Score=3254.0)

Get SNPs

For a gene

We find the genetic variants for the canonical transcript of BRCA2.

Note

The output is significantly truncated!

>>> from cogent.db.ensembl import Genome
>>> human = Genome('human', Release=81, account=account)
>>> brca2 = human.getGeneByStableId(StableId='ENSG00000139618')
>>> transcript = brca2.CanonicalTranscript
>>> print transcript.Variants
(<cogent.db.ensembl.region.Variation object at ...
>>> for variant in transcript.Variants:
...     print variant
...     break
Variation(Symbol='rs546292946'; Effect=['5_prime_UTR_variant', 'upstream_gene_variant', 'regulatory_region_variant']; Alleles='T/G')

Get a single SNP

We get a single SNP and print it’s allele frequencies.

>>> snp = list(human.getVariation(Symbol='rs34213141'))[0]
>>> print snp.AlleleFreqs
=================================
allele      freq    population_id
---------------------------------
     A    0.0303              918
     G    0.9697              918
     G    1.0000            11193
     G    1.0000            11504
     A                      11946
     G                      11946...

What alignment types available

We create a Compara instance for human, chimpanzee and macaque.

>>> from cogent.db.ensembl import Compara
>>> compara = Compara(['human', 'chimp', 'macaque'], Release=81,
...                  account=account)
>>> print compara.method_species_links
Align Methods/Clades
===================================================================================================================
method_link_species_set_id  method_link_id  species_set_id      align_method                            align_clade
-------------------------------------------------------------------------------------------------------------------
                       788              10           36176             PECAN           23 amniota vertebrates Pecan
                       756              13           35886               EPO                         8 primates EPO
                       780              13           36102               EPO               17 eutherian mammals EPO
                       781              14           36103  EPO_LOW_COVERAGE  39 eutherian mammals EPO_LOW_COVERAGE
-------------------------------------------------------------------------------------------------------------------

Get genomic alignment for a gene region

We first get the syntenic region corresponding to human gene BRCA2.

>>> from cogent.db.ensembl import Compara
>>> compara = Compara(['human', 'chimp', 'macaque'], Release=81,
...                  account=account)
>>> human_brca2 = compara.Human.getGeneByStableId(StableId='ENSG00000139618')
>>> regions = compara.getSyntenicRegions(region=human_brca2, align_method='EPO', align_clade='primates')
>>> for region in regions:
...     print region
SyntenicRegions:
  Coordinate(Human,chro...,13,32315473-32400266,1)
  Coordinate(Chimp,chro...,13,31957346-32041418,-1)
  Coordinate(Macaque,chro...,17,11686607-11779396,-1)...

We then get a cogent Alignment object, requesting that sequences be annotated for gene spans.

>>> aln = region.getAlignment(feature_types='gene')
>>> print repr(aln)
3 x 99492 dna alignment: Homo sapiens:chromosome:13:3231...

Parsing syntenic regions

Not all regions in a given genome have a syntenic alignment, and some have more than one alignment. To illustrate these cases, we can consider an alignment between mouse and human, using the PECAN alignment method in the vertebrates clade:

>>> species = ["mouse", "human"]
>>> compara = Compara(species, Release=66)
>>> clade = "vertebrates"
>>> chrom, start, end, strand = "X", 155754928, 155755079, "-"
>>> regions = compara.getSyntenicRegions(Species="mouse", CoordName=chrom,
...                                      Start=start, End=end, align_method="PECAN",
...                                      align_clade=clade, Strand=strand)
>>> aligned_pairs = [r for r in regions]
>>> alignment = aligned_pairs[0]
>>> aligned_regions = [m for m in alignment.Members
...                    if m.Region is not None]
>>> source_region, target_region = aligned_regions
>>> print source_region.Location.CoordName, source_region.Location.Start, source_region.Location.End
X 155754928 155755079
>>> print target_region.Location.CoordName, target_region.Location.Start, target_region.Location.End
X 20222659 20223163

Note

We took the aligned regions from the regions generator and put them in a list for convenience.

If there are no regions returned (i.e. num_pairs is zero), then no alignment could be found. In the case of the above region, an exon in the Hccs gene, there is only one alignment. We then accessed the coordinates of the alignment using the Members attribute of the region. Each element of aligned_regions is a SyntenicRegion instance, whose coordinates can be pulled from the Location attribute.

This example shows that mouse region X:155754928-155755079 aligns only to human region X:20222659-20223163.

Note

Sometimes, the genomic coordinates given to getSyntenicRegions will contain multiple alignments between the pair of genomes, in which case two or more regions will be returned in aligned_pairs.

PDB

For structures

The PDB module is very simple and basically gets a pdb coordinates file by accession number. Searches, etc. are not currently implemented because it’s easier to get the pdb ids from NCBI than to scrape PDB’s html results format.

>>> from cogent.db.pdb import Pdb
>>> p = Pdb()
>>> result = p['3L0U']

returns a handle to a file containing the PDB coordinates (that you can, for example, pass to the PDB parser in a fashion analogous to how you pass the GenBank record above to the RichGenbankParser). See the pdb parser documentation for more info. To send results directly to a file, you can use the retrieve() method of the Pdb object.